Sciencemadness Discussion Board

Tritium and nuclear chemistry

crazyboy - 31-1-2012 at 00:10

I was browsing Wikipedia when I stumbled upon an article on http://en.wikipedia.org/wiki/Tritium_illumination. In short the radioactive isotope of hydrogen, tritium, is composed of one proton and two neutrons. It occurs naturally in the atmosphere in trace amounts where it is produced by the interaction between atmospheric nitrogen and high energy cosmic rays.

Tritium decays into beta particles (electrons), as well as helium-3, and electron antineutrinos. Tritum has a half life of ~12.32 years. Radiation from tritium sources are not particularly dangerous because the relatively low energy particles cannot penetrate tissue.

Anyway, tritium can be used for illumination by using the process of radioluminescence whereby the beta particles produced by the tritium excite a phosphor such as zinc sulfide causing them to emit light. This property is utilized in some gun sights as well as exit signs to produce a long lived light source that does not require power.

I was just curious how feasible it would be to produce tritium by neutron bombardment of lithium-6 (a naturally occurring and stable isotope ~7.5% abundant in natural lithium) From a neutron source of americium/beryllium or polonium/beryllium.

I do not plan to attempt this process but it has peaked my interest. Anyway lithium-6 doesn't make up a very large percentage of lithium and the amount of neutrons produced by a pellet of the proposed neutron source would be very slight.

Some relevant links

Tritium
Americium as a neutron source
Radioluminescence
Polonium/beryllium neutron source

[Edited on 31-1-2012 by crazyboy]

[Edited on 31-1-2012 by crazyboy]

neptunium - 31-1-2012 at 11:10

a succesfull feasable activation with neutrons depand on different factors mainly the neutron cross section of the target element and the "temperature" of the neutrons,
6Li has a cross section of 0.045 barns compare with 10B 3837 barns!
neutrons from a Am/Be source are a little hot and need to be slow down to about 2Km/s to have a chance to activate anything ,this can be done by immersing the source and the target in an hydrogenated material (water ,wax etc..)

tritium like other beta emitters are not very toxic outside the body, inside ,its a different story.
they can seriusly dammaged tissues and bones , and it all come down to the biological half life and how well the element enter and stay in the biological system,

3H is not the only radioisotope capable of low energy beta rays and semi long half life , other can also be evacuated biologicaly by the body in case of injestion.

crazyboy - 31-1-2012 at 11:41

Quote: Originally posted by neptunium  
a succesfull feasable activation with neutrons depand on different factors mainly the neutron cross section of the target element and the "temperature" of the neutrons,
6Li has a cross section of 0.045 barns compare with 10B 3837 barns! neutrons from a Am/Be source are a little hot and need to be slow down to about 2Km/s to have a chance to activate anything ,this can be done by immersing the source and the target in an hydrogenated material (water ,wax etc..)


Actually

Quote:

the large neutron absorption cross-section of 6Li (941 barns, thermal) versus the small neutron absorption cross-section of 7Li (0.045 barns, thermal) make strict isotopic separation of lithium a requirement for fluoride reactor use.


Isotopes of lithium
And:
Quote:

Tritium is produced in nuclear reactors by neutron activation of lithium-6. This is possible with neutrons of any energy

Quote:

High-energy neutrons can also produce tritium from lithium-7 in an endothermic reaction, consuming 2.466 MeV

neptunium - 31-1-2012 at 11:45

i copied the wrong value of Li7 instead sorry about that...

neptunium - 31-1-2012 at 11:47

there is other isotope easier to produce than 3H ...but i guess it could be salvage from nuclear power plant thats a fact tritium is usually released in the atmosphere

[Edited on 31-1-2012 by neptunium]

Wizzard - 31-1-2012 at 12:25

It would be much easier to just purchase tritium in small vials, on Ebay :)

But an americium 241/Be foil could generate some tritium gas from lithium, albiet in an insignificant quantity. I would get a Be foil, strap a mess of Am241 smoke detector buttons to it, and put a rather thick slice of Lithium on the other end of the foil. Li7 will not absorb the neutrons, but Li6 will. Perhaps make sure the tritium can escape the lithium, also... Put the whole apparatus in a sealed glass vessel/vacuum (but also cool it, the Lithium will evaporate).

I think it could be figured out how many Am241 buttons would be needed to generate enough Tritium that it would not degenerate faster than it is made :)

entropy51 - 31-1-2012 at 14:22

Quote: Originally posted by Wizzard  
I think it could be figured out how many Am241 buttons would be needed to generate enough Tritium that it would not degenerate faster than it is made :)
8,435,627 would be needed.

Well, a lot. A smoke detector contains only about a microcurie of Am241. I think the neutron yield from a microcurie on Be would only be of the order of 100 neutrons per second if intimately mixed with Be powder.

Anyone thinking of taking the Am out of smoke detectors should Google David Hahn aka Radioactive Boy Scout. Beryllium powder presents its own toxicity problems as well.

I won't even bother to mention that taking the Am out of smoke detectors violates NRC regulations and they are not a forgiving bunch.

neptunium - 1-2-2012 at 07:31

not only its illegal but worse! its useless!

aliced25 - 7-6-2013 at 02:37

LiBeD4, now strap some Americium buttons on that sucker:D Especially if one enriches lithium by distillation to get Li6

Solomon - 25-6-2013 at 14:58

is there a way to measure the temperature of neutrons? And also, how could someone isolate radium from it's salt?

Endimion17 - 25-6-2013 at 23:35

Quote: Originally posted by Solomon  
is there a way to measure the temperature of neutrons? And also, how could someone isolate radium from it's salt?


Yes, but I think that's way outside the scope of pretty much anyone at home, unless you've got a lot of money to build sophisticated machinery.

Radium can be isolated by electrolysis of the molten chloride, or I think by the reduction with calcium, to name the most famous ways. Both things are incredibly dangerous outside specialized equipment (think about Sellafield) and would certainly result in the painful death of the person isolating it and anyone living in the same apartment because of the contamination and hard radiation going everywhere.
That's a furiously radioactive earth alkali metal low in the periodic group, meaning it's very chemically reactive. Think of it as very dense metal similar in reactivity to sodium or lithium, but with its oxidized surface faintly glowing blue in the dark because it's radiating so much energy it would kill you in no time. It releases a lot of alpha rays, its daughter nuclei release an ample amount of beta, and all together they release pretty hard gamma rays.
You really can't work safely with it without a hot cell. It's a scary metal.

Solomon - 3-7-2013 at 09:24

I am sure I could get that amount of money if necessary. Even if I can't, I would still be interested in learning how an apparatus measuring neutron speed (heat or energy) is made. Also if you were to do this, I am guessing that an advanced vacuum chamber would be necessary.

[Edited on 7-3-2013 by Solomon]

unionised - 3-7-2013 at 10:12

One of these
http://www.sii.co.jp/jp/segg/files/2013/03/file_PRODUCT_MAST...
and some sort of neutron detector would let you measure the speed of the neutrons.
In principle, it's a very simple piece of equipment.

watson.fawkes - 3-7-2013 at 10:24

Quote: Originally posted by Solomon  
is there a way to measure the temperature of neutrons?
Yes.

woelen - 3-7-2013 at 10:25

Quote: Originally posted by Wizzard  
It would be much easier to just purchase tritium in small vials, on Ebay :)

Are you joking or do you seriously mean this?

Suppose you have 1 gram of heavy water based on tritium (T2O) in a small vessel. What energy output do you expect? It would instantly explode in a white hot fire ball, simply due to the release of tremendous amounts of energy from its redioactive decay. Commercial samples of tritium, used for lighting purposes contain the material in nanogram or maybe microgram quantities at dilutions of 1 to a million or even more.

Just to get an idea of the intensity of the energy, coming from this. If you have a piece of plutonium, the size of a tennis ball, then that piece will be luke warm to the touch, due to the energy released by radioactive decay. Plutonium has a half life of appr. 25000 years. What do you expect from something with a half life of 12.5 years? I have seen pictures on internet of a compound with a half life of 500 years. It emits red/orange light, simply because of the intense heat released due to its radioactive decay.

What you probably have seen are ampoules of heavy water, containing deuterium instead of tritium. Such ampoules can be obtained for prices of a few tens of dollars or euros per 10 ml or so. I myself have a nice gas tube, filled with D2, which emits a nice salmon light when submitted to high frequency high voltage. But again, this is deuterium, not tritium. Deuterium is a stable isotope of hydrogen.

[Edited on 3-7-13 by woelen]

Wizzard - 3-7-2013 at 13:53

I have two 'vials' of Tritium - They are pretty common on Ebay, although mine came from a private collection.

I apologize for the quality - My camera is pitiful at low light.


IMG_20130703_174948.jpg - 142kB

[Edited on 7-3-2013 by Wizzard]

bfesser - 3-7-2013 at 16:14

Quote: Originally posted by Solomon  
is there a way to measure the temperature of neutrons? And also, how could someone isolate radium from it's salt?
Educate yourself, young one: <a href="http://en.wikipedia.org/wiki/Neutron_temperature" target="_blank">Neutron temperature</a> <img src="../scipics/_wiki.png" />.
<a href="http://en.wikipedia.org/wiki/Radium#Radioactivity" target="_blank">
Quote:
Radium is three million times as radioactive as the same mass of uranium. <img src="../scipics/_wiki.png" />
</a>We cannot overemphasize how dangerous radium is! If you attempt to isolate it, you <em>will</em> die as a direct result. It's not a matter of if, but a matter of when.

If you're interested in radium, let me suggest reading about it, rather than attempting to experiment with it. I thoroughly enjoyed reading and highly recommend <a href="http://books.google.com/books/about/Deadly_sunshine.html?id=5UkfAQAAIAAJ" target="_blank"><em>Deadly Sunshine: The History and Fatal Legacy of Radium</em> by David I. Harvie</a> <img src="../scipics/_ext.png" />.

[Edited on 7/9/13 by bfesser]

Solomon - 3-7-2013 at 17:36

I have seen this wikipedia page bfesser, but knowing the temperatures of different neutrons is useless unless I knew the temperature of the ones I was dealing with. Perhaps if I knew the temperatures of the neutrons of different radioactive materials when their alpha rays go through beryllium. EX: when alpha rays from these compounds react with beryllium they produce neutrons of: Radium = ?ev, Americium = ?ev, Thorium = ?ev, Uranium = ?ev, tellurium = ?ev, polonium = ?ev, etc.... Perhaps if I had a chamber that could measure neutrons and I put it lets say 500 feet from a neutron source and had a sensor attached to it that detected major neutron fluxes. So I have the neutrons shielded and then when I want to measure their sped, then simply remove the barrier and measure how many millionths of a second it took for the neutrons to reach the detection chamber and thus measure the speed (temperature) of the neutrons.

phlogiston - 4-7-2013 at 02:30

Quote:
perhaps if I had a chamber that could measure neutrons and I put it lets say 500 feet from a neutron source and had a sensor attached to it that detected major neutron fluxes. So I have the neutrons shielded and then when I want to measure their sped, then simply remove the barrier and measure how many millionths of a second it took for the neutrons to reach the detection chamber and thus measure the speed (temperature) of the neutrons.


Yes, that is definately easier than looking it up.

http://www.safetyoffice.uwaterloo.ca/hse/radiation/rad_seale...

Additionally, there may be some commercial value in the incredibly fast shutter you will develop to open/close the neutron shielding.

Please do be a bit careful with a neutron source powerfull enough to be detectable 500 feet away, especially in an amateur science setting.

[Edited on 4-7-2013 by phlogiston]

neptunium - 4-7-2013 at 06:46

I have been working for sometimes at this particle accelerator that would produce neutron at desired temperature and flow (more or less controllable via electron gun and high voltage)it is increadibly difficult and tidius for one and some energy are out of reach for the home scientist..i dint give up on my ideas but after 10 years of very little results I am loosing patience and money is always an issue ...

however I find it so interesting cant help my self!

Endimion17 - 4-7-2013 at 07:29

Quote: Originally posted by woelen  
Quote: Originally posted by Wizzard  
It would be much easier to just purchase tritium in small vials, on Ebay :)

Are you joking or do you seriously mean this?

Suppose you have 1 gram of heavy water based on tritium (T2O) in a small vessel. What energy output do you expect? It would instantly explode in a white hot fire ball, simply due to the release of tremendous amounts of energy from its redioactive decay. Commercial samples of tritium, used for lighting purposes contain the material in nanogram or maybe microgram quantities at dilutions of 1 to a million or even more.

Just to get an idea of the intensity of the energy, coming from this. If you have a piece of plutonium, the size of a tennis ball, then that piece will be luke warm to the touch, due to the energy released by radioactive decay. Plutonium has a half life of appr. 25000 years. What do you expect from something with a half life of 12.5 years? I have seen pictures on internet of a compound with a half life of 500 years. It emits red/orange light, simply because of the intense heat released due to its radioactive decay.

What you probably have seen are ampoules of heavy water, containing deuterium instead of tritium. Such ampoules can be obtained for prices of a few tens of dollars or euros per 10 ml or so. I myself have a nice gas tube, filled with D2, which emits a nice salmon light when submitted to high frequency high voltage. But again, this is deuterium, not tritium. Deuterium is a stable isotope of hydrogen.

[Edited on 3-7-13 by woelen]


I haven't been able to find much info on T<sub>2</sub>O, only that it's corrosive (how much?) due to self radiolysis.

I found that PerkinElmer sells vials of what is obviously a solution of T<sub>2</sub>O in water.
As usual, MSDS is a rampant celebration of idiotic uselessness, but there's this interesting info that its radioactivity is approximately 2.5 x10e6 DPM, which is a bit over 41.6 kBq. (1 disintegration per minute = 60 becquerels)

Let's do a calculation.
Radioactivity of pure <sup>3</sup>H<sub>2</sub> at standard conditions is 357 TBq/g, therefore 1 g of it has 357 TBq.
Let's assume we have a vial with 1 g of pure T<sub>2</sub>O. Tritium's weight percentage in it is 13.689%, so 1 g can yield 0.273 g of <sup>3</sup>H<sub>2</sub>.

Radioactivity of 0.273 g of <sup>3</sup>H<sub>2</sub> is 0.273 g * 357 x10e12 Bq/g = 97.416 TBq

and that's the total radioactivity of 1 g of fresh, pure T<sub>2</sub>O.

If the tritiated water sample that PerkinElmer sells contains 41.666 kBq/g of radioactivity, 1 g of their sample would contain 4.2771 x10e-10 g of T<sub>2</sub>O, or 0.4277 ng of it.

Needless to say, if my calculations are correct, such samples are almost completely harmless. They're used for various purposes in life sciences and do not require shielding. Decay energy (beta) is 5.7 keV which reaches 5 mm in air and 5 μm in water.

Pure sample of T<sub>2</sub>O, with its halftime of decay 12.3 years would probably be a contamination hazard in the sense that it would heat itself and evaporate at an elevated rate.
I'm not sure how much, given the fact its decay energy is only 5.7 keV.
For example, <sup>239</sup>Pu decays by alpha particles and the energy is 5.245 MeV.
Alpha particles are much more massive than electrons and bump into matter easily, transferring energy, so it's understandable that, with even 24100 years of half life, the sample is warm to the touch.

<sup>3</sup>H releases wimpy electrons. Even with only 12.3 years of halftime, I doubt that if some kind of deus ex machina replicator would create a blob of T<sub>2</sub>O, it would explode because of sudden overheating in a ball of luminous plasma.

I presume it would be warm, outgassing slowly due to evaporation and radiolysis. The sample would effectively destroy itself, and if left sealed, there'd be a large buildup of oxygen, hydrogen, tritium in various isotopic combinations.
In short words, such ampule would be very dangerous as it would burst one day.

watson.fawkes - 4-7-2013 at 10:41

Quote: Originally posted by Solomon  
I have seen this wikipedia page bfesser, but knowing the temperatures of different neutrons is useless unless I knew the temperature of the ones I was dealing with. Perhaps if I knew the temperatures of the neutrons of different radioactive materials when their alpha rays go through beryllium.
If you way you've seen that page, I have to conclude you must not have read that page. Iit's certainly not apparent that you've read it from the questions you're asking. It's also fairly apparent that you've hardly read anything linked on that page, particularly about neutron detectors.

If you want to do something productive, propose (to yourself) an actual experiment of pretty much any sort, work out as much of it as you are able, and then ask questions.

Frankly, you need starter projects. Build a Geiger counter first, if you're interested in radiation. I suspect that will take you a few months to work out something relatively simple like that all by itself.

Solomon - 4-7-2013 at 11:37

Thank you watson.fawkes... I missed that before. "Detection software consists of analysis tools that perform tasks such as graphical analysis to measure the number and energies of neutrons striking the detector." Apparently a standard detector is fine if altered with some detection equipment.

bfesser - 4-7-2013 at 12:03

Sillymon, I wonder, do you have any chemistry interests outside of radioactive and energetic materials? Perhaps we could suggest other experiments or avenues of research for you. I, myself, have been thinking about purchasing and putting together one of these <a href="http://en.wikipedia.org/wiki/Geiger%E2%80%93M%C3%BCller_tube" target="_blank">Geiger–Müller tube</a> <img src="../scipics/_wiki.png" /> based radiation counter <a href="http://mightyohm.com/blog/products/geiger-counter/" target="_blank">kits</a>, for use as a practical tool in my mineral collecting. I've also thought about connecting it to a <a href="http://www.raspberrypi.org/faqs" target="_blank">Raspberry Pi</a> or an <a href="http://arduino.cc/en/" target="_blank">Arduino</a>, along <a href="http://www.adafruit.com/blog/2013/01/24/adafruit-ultimate-gps-on-the-raspberry-pi-raspberry_pi-raspberrypi/" target="_blank">with a GPS receiver</a> so I can map local background radiation on my rock-collecting hikes.

[Edited on 7/9/13 by bfesser]

watson.fawkes - 4-7-2013 at 12:24

Quote: Originally posted by Solomon  
Apparently a standard detector is fine if altered with some detection equipment.
Read more. This advice will benefit everyone. Neutron detection is significantly more complicated that you are aware.

Solomon - 4-7-2013 at 23:41

Yes bfesser, I am interested in the improvement of the human genome to create people born with better verbal reasoning, perceptual reasoning, and memory scores on the IQ test. BGI is currently working on this. Unfortunately, as I find it inhumane to irradiate millions of people to randomly produce superior ones, I must learn controlled biological modification which is HARD and I will need years if not decades to master this science. However, random radiological mutations are fine with plants. I have learned how to make a geiger counter bfesser using several methods. I will be interested if you come up with any fascinating science suggestions.

[Edited on 7-5-2013 by Solomon]

phlogiston - 5-7-2013 at 01:05

You watch too many movies. This thread is getting more ridiculous with every post.

Quote:
am interested in the improvement of the human genome to create people born with better verbal reasoning, perceptual reasoning, and memory scores on the IQ test
...-snip-... I must learn controlled biological modification which is HARD and I will need years if not decades to master this science


It is not hard at all, it is routinely done with mice and all kinds of other organisms, but it is unethical in humans. It is illegal for good reasons IMO, but technically possible today.

The hard part is to find out what mutations to make to get what you want, and this is way beyond our understanding/abilites. It will take major advances in the genetics of brain structure and brain development. We will not be able to do this for several decades at least, but perhaps as much as a century or more.

Next time, don't rent a DVD but get a few real books and spend your time reading. You will find that real science is actually -more- fascinating than science fiction.



Quote: Originally posted by Endimion17  

Radioactivity of 0.273 g of <sup>3</sup>H<sub>2</sub> is 0.273 g * 357 x10e12 Bq/g = 97.416 TBq

and that's the total radioactivity of 1 g of fresh, pure T<sub>2</sub>O.

Decay energy (beta) is 5.7 keV which reaches 5 mm in air and 5 μm in water.


So, 97.416 * 1012 * 5700 = 5.55 * 1017 eV per second

1 eV = 1.602 * 10-19 joules

so a gram of T2O would generate about 89 mJ.

It takes 4.184 joules to raise the temperature of 1 gram of T2O by 1 degree celcius, so assuming it will not dissipate energy to its surroundings and it absorbs all of its own beta-particles, <b>it would heat up 1 degree every 47 seconds</b>

So, I guess it will become noticeable warm and could boil from its own heat if it was thermally insulated, but I suspect you can keep it if you store it in a closed container which allows the heat to dissipate.

No instantaneous puff of smoke but still a challenge to store safely.

I recall that the ferociously radioactive element radium produces enough heat to melt its own weight in ice every hour. To me, that was surprisingly little.


[Edited on 5-7-2013 by phlogiston]

annaandherdad - 5-7-2013 at 08:30

Woelen's and phlogiston's posts reminded me of an old question in my mind. The Ivy Mike device was the first hydrogen bomb detonated by the United States, and it used cryogenic fuel. I had always assumed that fuel was deuterium+tritium, but it had left me wondering how they could ever purify, much less liquify, tritium, in view of the heat it generates by its own radioactivity. Now on research (ie, consulting wikipedia) I find that the Ivy Mike device used cryogenic deuterium, but no tritium. This was surprising because DD fusion requires much higher temperatures and yields lower energy than DT fusion. Most designs for modern fusion reactors are based on DT. Also, solid fuel hydrogen bombs make use of the DT reaction, where the tritium is produced by fission of lithium.

Solomon - 5-7-2013 at 10:27

I figure we just look at genetic sequence differences in high IQ people and finding the genes that are similar in the high IQ people but different in the low IQ people, we may be able to change these sequences and observe their effects. EX: Low IQ person's gene sequence:
ATGCCGGTTTATCCAAAAATTTGG
TACGGCCAAATAGGTTTTTAAACC
High IQ persons gene sequence at the same point on the chromosome:
ATTAACCAAACGAAGCTCGAAGCC
TAATTGGTTTGCTTCGAGCTTCGG
If these differences are changed, they may work to increase the human intelligence. Of course many control different traits, but some will control the brain and with thousands of tries, we can find and isolate the IQ genes. Feasible?

Endimion17 - 5-7-2013 at 10:33

Quote: Originally posted by Solomon  
I figure we just look at genetic sequence differences in high IQ people and finding the genes that are similar in the high IQ people but different in the low IQ people, we may be able to change these sequences and observe their effects. EX: Low IQ person's gene sequence:
ATGCCGGTTTATCCAAAAATTTGG
TACGGCCAAATAGGTTTTTAAACC
High IQ persons gene sequence at the same point on the chromosome:
ATTAACCAAACGAAGCTCGAAGCC
TAATTGGTTTGCTTCGAGCTTCGG
If these differences are changed, they may work to increase the human intelligence. Of course many control different traits, but some will control the brain and with thousands of tries, we can find and isolate the IQ genes. Feasible?


May I ask how old are you and what background education you have? It's ok if you don't want to release such information online.

Solomon - 5-7-2013 at 22:35

I am 15 and have only a sophomore level education. Most of what I know, I have taught myself via the internet.

phlogiston - 6-7-2013 at 00:59

Quote: Originally posted by Solomon  
I figure we just look at genetic sequence differences in high IQ people and finding the genes that are similar in the high IQ people but different in the low IQ people ... - snip- .... Feasible?


Ah, now that is indeed a reasonable idea.
In fact, it is a good idea, and modern sequencing techniques have made it actually possible to do this in recent years. Therefore, you will not be surprised to hear that is has been done before.
Many times, with increasing numbers of people, with different groups (random sample of population / extremely high IQ versus normal IQ / etc etc) and with increasingly good sequencing techniques etc.

Essentially, the result of all this work has consistently been that there probably is not a single or a few 'IQ genes'. Many small differences have been identified that each have a small effect.
So, IQ is a so-called 'complex trait'.

Of many of these 'polymorphisms' (=differences in the DNA of healthy individuals) the effect and the gene(s) it affects is not known or understood, so there is a lot of interesting work ahead of us trying to work out exactly how they affect the brain and presumably IQ.


[Edited on 6-7-2013 by phlogiston]