| Pages:
1
2 |
Solomon
Hazard to Self
Posts: 82
Registered: 24-6-2013
Location: Ancient Mines
Member Is Offline
Mood: FOR SCIENCE!
|
|
Yes bfesser, I am interested in the improvement of the human genome to create people born with better verbal reasoning, perceptual reasoning, and
memory scores on the IQ test. BGI is currently working on this. Unfortunately, as I find it inhumane to irradiate millions of people to randomly
produce superior ones, I must learn controlled biological modification which is HARD and I will need years if not decades to master this science.
However, random radiological mutations are fine with plants. I have learned how to make a geiger counter bfesser using several methods. I will be
interested if you come up with any fascinating science suggestions.
[Edited on 7-5-2013 by Solomon]
|
|
|
phlogiston
International Hazard
Posts: 1379
Registered: 26-4-2008
Location: Neon Thorium Erbium Lanthanum Neodymium Sulphur
Member Is Offline
Mood: pyrophoric
|
|
You watch too many movies. This thread is getting more ridiculous with every post.
| Quote: | am interested in the improvement of the human genome to create people born with better verbal reasoning, perceptual reasoning, and memory scores on
the IQ test
...-snip-... I must learn controlled biological modification which is HARD and I will need years if not decades to master this science
|
It is not hard at all, it is routinely done with mice and all kinds of other organisms, but it is unethical in humans. It is illegal for good reasons
IMO, but technically possible today.
The hard part is to find out what mutations to make to get what you want, and this is way beyond our understanding/abilites. It will take major
advances in the genetics of brain structure and brain development. We will not be able to do this for several decades at least, but perhaps as much as
a century or more.
Next time, don't rent a DVD but get a few real books and spend your time reading. You will find that real science is actually -more- fascinating than
science fiction.
Quote: Originally posted by Endimion17  |
Radioactivity of 0.273 g of <sup>3</sup>H<sub>2</sub> is 0.273 g * 357 x10e12 Bq/g = 97.416 TBq
and that's the total radioactivity of 1 g of fresh, pure T<sub>2</sub>O.
Decay energy (beta) is 5.7 keV which reaches 5 mm in air and 5 μm in water.
|
So, 97.416 * 1012 * 5700 = 5.55 * 1017 eV per second
1 eV = 1.602 * 10-19 joules
so a gram of T2O would generate about 89 mJ.
It takes 4.184 joules to raise the temperature of 1 gram of T2O by 1 degree celcius, so assuming it will not dissipate energy to its surroundings and
it absorbs all of its own beta-particles, <b>it would heat up 1 degree every 47 seconds</b>
So, I guess it will become noticeable warm and could boil from its own heat if it was thermally insulated, but I suspect you can keep it if you store
it in a closed container which allows the heat to dissipate.
No instantaneous puff of smoke but still a challenge to store safely.
I recall that the ferociously radioactive element radium produces enough heat to melt its own weight in ice every hour. To me, that was surprisingly
little.
[Edited on 5-7-2013 by phlogiston]
-----
"If a rocket goes up, who cares where it comes down, that's not my concern said Wernher von Braun" - Tom Lehrer |
|
|
annaandherdad
Hazard to Others
Posts: 389
Registered: 17-9-2011
Member Is Offline
Mood: No Mood
|
|
Woelen's and phlogiston's posts reminded me of an old question in my mind. The Ivy Mike device was the first hydrogen bomb detonated by the United
States, and it used cryogenic fuel. I had always assumed that fuel was deuterium+tritium, but it had left me wondering how they could ever purify,
much less liquify, tritium, in view of the heat it generates by its own radioactivity. Now on research (ie, consulting wikipedia) I find that the Ivy
Mike device used cryogenic deuterium, but no tritium. This was surprising because DD fusion requires much higher temperatures and yields lower energy
than DT fusion. Most designs for modern fusion reactors are based on DT. Also, solid fuel hydrogen bombs make use of the DT reaction, where the
tritium is produced by fission of lithium.
Any other SF Bay chemists?
|
|
|
Solomon
Hazard to Self
Posts: 82
Registered: 24-6-2013
Location: Ancient Mines
Member Is Offline
Mood: FOR SCIENCE!
|
|
I figure we just look at genetic sequence differences in high IQ people and finding the genes that are similar in the high IQ people but different in
the low IQ people, we may be able to change these sequences and observe their effects. EX: Low IQ person's gene sequence:
ATGCCGGTTTATCCAAAAATTTGG
TACGGCCAAATAGGTTTTTAAACC
High IQ persons gene sequence at the same point on the chromosome:
ATTAACCAAACGAAGCTCGAAGCC
TAATTGGTTTGCTTCGAGCTTCGG
If these differences are changed, they may work to increase the human intelligence. Of course many control different traits, but some will control the
brain and with thousands of tries, we can find and isolate the IQ genes. Feasible?
|
|
|
Endimion17
International Hazard
Posts: 1468
Registered: 17-7-2011
Location: shores of a solar sea
Member Is Offline
Mood: speeding through time at the rate of 1 second per second
|
|
| Quote: Originally posted by Solomon | I figure we just look at genetic sequence differences in high IQ people and finding the genes that are similar in the high IQ people but different in
the low IQ people, we may be able to change these sequences and observe their effects. EX: Low IQ person's gene sequence:
ATGCCGGTTTATCCAAAAATTTGG
TACGGCCAAATAGGTTTTTAAACC
High IQ persons gene sequence at the same point on the chromosome:
ATTAACCAAACGAAGCTCGAAGCC
TAATTGGTTTGCTTCGAGCTTCGG
If these differences are changed, they may work to increase the human intelligence. Of course many control different traits, but some will control the
brain and with thousands of tries, we can find and isolate the IQ genes. Feasible? |
May I ask how old are you and what background education you have? It's ok if you don't want to release such information online.
|
|
|
Solomon
Hazard to Self
Posts: 82
Registered: 24-6-2013
Location: Ancient Mines
Member Is Offline
Mood: FOR SCIENCE!
|
|
I am 15 and have only a sophomore level education. Most of what I know, I have taught myself via the internet.
|
|
|
phlogiston
International Hazard
Posts: 1379
Registered: 26-4-2008
Location: Neon Thorium Erbium Lanthanum Neodymium Sulphur
Member Is Offline
Mood: pyrophoric
|
|
| Quote: Originally posted by Solomon | | I figure we just look at genetic sequence differences in high IQ people and finding the genes that are similar in the high IQ people but different in
the low IQ people ... - snip- .... Feasible? |
Ah, now that is indeed a reasonable idea.
In fact, it is a good idea, and modern sequencing techniques have made it actually possible to do this in recent years. Therefore, you will not be
surprised to hear that is has been done before.
Many times, with increasing numbers of people, with different groups (random sample of population / extremely high IQ versus normal IQ / etc etc) and
with increasingly good sequencing techniques etc.
Essentially, the result of all this work has consistently been that there probably is not a single or a few 'IQ genes'. Many small differences have
been identified that each have a small effect.
So, IQ is a so-called 'complex trait'.
Of many of these 'polymorphisms' (=differences in the DNA of healthy individuals) the effect and the gene(s) it affects is not known or understood, so
there is a lot of interesting work ahead of us trying to work out exactly how they affect the brain and presumably IQ.
[Edited on 6-7-2013 by phlogiston]
-----
"If a rocket goes up, who cares where it comes down, that's not my concern said Wernher von Braun" - Tom Lehrer |
|
|
| Pages:
1
2 |
![[*]](images/xpblue/default_icon.gif){kind=icon}
