The Iron Binding Integrase
This was a protein hybrid from long ago which May or may not work, Iron Binding Integrase, which is Integrase from HIV which usually binds to DNA
which instead has been reengineered to bind to Iron with the part of Hemoglobin that binds to Iron in blood cells.
Integrase with DNA bound to it.
Hemoglobin with Iron in it.
Iron Binding Integrase.
The only thing about this is you never know if it will work or not until physically tested with Splicing proteins together, the Code may say that it
Is the same as when they were apart, but will it still fold the same way maybe not.
Iron Binding Integrase DNA Code.
Integrase without part of Red Region with Hemoglobin section 2
atggtgctgagcccggcggataaaaccaacgtgaaagcggcgtggggcaaagtgggcgcg
catgcgggcgaatatggcgcggaagcgctggaacgcatgtttctgagctttccgaccacc
aaaacctattttccgcattttgatctgagccatggcagcgcgcaggtgaaaggccatggc
aaaaaagtggcggatgcgctgaccaacgcggtggcgcatgtggatgatatgccgaacgcgctgagcgcgctgagcgatctgcatgcgcataaactgcgcgtggatccggtgaactttaaa
ctgctgagccattgcctgctggtgaccctggcggcgcatctgccggcggaatttaccccg
gcggtgcatgcgagcctggataaatttctggcgagcgtgagcaccgtgctgaccagcaaa
tatcgcaac tagcagacca actaattcat ctgtattactttgactgttt ttcagactct gctataagaa aggccttatt aggacacata gttagccctaggtgtgaata tcaagcagga cataacaagg taggatctct
acaatacttg gcactagcagcattaataac accaaaaaag ataaagccac ctttgcctag tgttacgaaa ctgacagaggatagatggaa caagccccag aagaccaagg gccacagagg gagccacaca
atgaatggac
[Edited on 18-12-2017 by Vmedvil]
|
![[*]](images/xpblue/default_icon.gif){kind=icon}
